Build the application

## Build
Inspect multi-transcript FASTA packages from NCBI Datasets to detect reading frame shifts. Translate sequences using Biopython and structure discrepancy logs into FHIR Observation payloads.

## User
Transcriptomics Specialist

## Workflow
1. Ingest CDS FASTA files downloaded via NCBI Datasets command-line utility.
2. Translate coding nucleotide sequences using Biopython standard genetic code translation tables.
3. Check for expected start codons, absence of internal stops, and exact nucleotide triplet multiples.
4. Format verification summaries into FHIR Molecular Observation entries with flagged discrepancy codes.

## Interface
Terminal command-line utility with side-by-side terminal rendering of nucleotide triplets and amino acids.

## Data
Download human transcript packages for gene IDs 1, 2, and 3 using NCBI Datasets sandbox mocks.
Starter examples below are synthetic. They are not downloaded records.

## Source
[NCBI Datasets gene download](https://www.ncbi.nlm.nih.gov/datasets/docs/v2/how-tos/genes/download-gene-data-package/)
Uses NCBI Datasets command 'datasets download gene gene-id 1 2 3 --include cds' to retrieve coding sequences.

## Tools
ollama, biopython, pydantic-ai.
Runs local open language models to generate explanations of translational discrepancies without external API costs.
Local deployment of an instruction-tuned model such as Llama 3 8B via Ollama.

## Deliverables
Submit runnable source, pinned dependencies, setup commands, a working interface, example outputs, and a recorded end-to-end demo. Include tests and an action log.

## Acceptance
- Translates CDS sequences into peptide strings using Biopython Bio.Seq module.
- Detects non-triplet CDS lengths and flags them with explicit frameshift indicators.
- Exports valid FHIR R5 Observation resources containing codon length and frame evaluation.

## Starter Examples
```json
[
  {
    "input": {
      "cds_id": "CDS_001",
      "sequence": "ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG"
    },
    "expected_output": {
      "cds_id": "CDS_001",
      "length_bp": 39,
      "is_triplet_multiple": true,
      "start_codon_valid": true,
      "internal_stops_count": 1,
      "validation_status": "flagged_internal_stop"
    }
  },
  {
    "input": {
      "cds_id": "CDS_002",
      "sequence": "ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATA"
    },
    "expected_output": {
      "cds_id": "CDS_002",
      "length_bp": 38,
      "is_triplet_multiple": false,
      "start_codon_valid": true,
      "internal_stops_count": 0,
      "validation_status": "frameshift_length_anomaly"
    }
  }
]
```

## Safety
Research transcript analysis only; no clinical diagnostic determinations or genetic counseling advice.
Use mock external writes. Require human review before any real deployment.