Build a Research Specimen Biopython Quality Control and Terminology Mapper

Evaluate sequencing run quality metrics from FASTA files and align specimen metadata to standard terminology. Structure results into FHIR Specimen and ResearchStudy observation entities.

Laboratory Operations Specialist

Read raw specimen FASTA sequences using Biopython SeqIO.

Calculate GC percentage and ambiguity counts for each sample record.

Validate sample metadata against FHIR Foundation administration resource models.

Format audit summaries into structured QC reports for human sign-off.

Web dashboard showing specimen batch QC tables with downloadable FHIR JSON manifests.

Generate synthetic FASTA files with varied nucleotide compositions and simulated specimen identifiers. Starter examples below are synthetic. They are not downloaded records.

Biopython Leverages Biopython's core SeqIO module for parsing FASTA files and calculating sequence composition stats.

mastra-ai, biopython, fastapi. Mastra AI provides declarative workflow orchestration to link parsing, terminology matching, and report generation. Fast hosted model or local Ollama instance for contextual anomaly explanations in QC summaries.

Submit runnable source, pinned dependencies, setup commands, a working interface, example outputs, and a recorded end-to-end demo. Include tests and an action log.

Biopython SeqIO correctly calculates GC content and flags degenerate base thresholds.

Generates valid FHIR Specimen JSON representations with accurate status values.

Includes a human review staging queue for rejected specimens.

```json [ { "input": { "specimen_id": "SPEC-001", "sequence_header": ">sample_01 human_control", "sequence": "GCGCGCGCATATATATGCGC" }, "expected_output": { "specimen_id": "SPEC-001", "length": 20, "gc_content_pct": 60, "qc_status": "PASS", "fhir_resource": "Specimen" } }, { "input": { "specimen_id": "SPEC-002", "sequence_header": ">sample_02 degraded_isolate", "sequence": "NNNNNNCGATNNN" }, "expected_output": { "specimen_id": "SPEC-002", "length": 13, "gc_content_pct": 30.77, "qc_status": "FAIL_HIGH_AMBIGUITY", "fhir_resource": "Specimen" } } ] ```

Confined to pre-analytical laboratory assay quality checks using deidentified research identifiers. Use mock external writes. Require human review before any real deployment.