Build a Prokaryotic RefSeq Annotation Verification Assistant
Inspect prokaryotic WP_ accession metadata and FASTA packages from NCBI Datasets. Verify translational completeness and generate FHIR Molecular Observation entries for microbiology research.
What you are building
The core problem, expected build, and operating context for this challenge.
Inspect prokaryotic WP_ accession metadata and FASTA packages from NCBI Datasets. Verify translational completeness and generate FHIR Molecular Observation entries for microbiology research.
Microbial Genomicist
Download prokaryotic gene packages specified by RefSeq WP_ accessions through NCBI Datasets.
Parse prokaryotic protein and gene multi-FASTA files using Biopython Bio.SeqIO module.
Translate genomic coding intervals to check concordant peptide lengths and terminal residues.
Generate FHIR Molecular Observation JSON payloads detailing translation congruence.
Console dashboard displaying accession parsing progress, peptide length delta indicators, and JSON downloads.
Fetch synthetic WP_ bacterial accessions using mock zip payloads simulating NCBI Datasets CLI prokaryotic outputs. Starter examples below are synthetic. They are not downloaded records.
NCBI Datasets gene download Uses NCBI Datasets prokaryotic data package rules specifically handling WP_ accessions containing gene and protein files.
mastra-ai, biopython, fastapi. Provides structured TypeScript and Node agent workflows to orchestrate command execution and schema validation. Standard API endpoint with robust JSON schema formatting capabilities.
Submit runnable source, pinned dependencies, setup commands, a working interface, example outputs, and a recorded end-to-end demo. Include tests and an action log.
Identifies peptide length discrepancies between translated nucleotide sequences and RefSeq protein entries.
Generates valid FHIR Observation resources with code system pointing to RefSeq accessions.
Correctly flags premature termination codons inside prokaryotic CDS sequences.
```json [ { "input": { "accession": "WP_010890123.1", "gene_nt": "ATGAAACGTACTCTGGTATTGTCAGGTGCGATGACCATCGGTACTGGTCTGTAA", "protein_aa": "MKRTLVLSGAMTIGTGL" }, "expected_output": { "status": "congruent", "accession": "WP_010890123.1", "nt_length": 54, "aa_length": 17, "length_match": true, "fhir_code": "WP_010890123.1" } }, { "input": { "accession": "WP_010890999.1", "gene_nt": "ATGAAACGTACTCTGGTATAATCAGGTACTGGTCTGTAA", "protein_aa": "MKRTLVLSGAMTIGTGL" }, "expected_output": { "status": "mismatch", "accession": "WP_010890999.1", "nt_length": 39, "aa_length": 17, "length_match": false, "internal_stop_codon": true, "fhir_code": "WP_010890999.1" } } ] ```
Strictly for research microbiology and public bacterial data curation; excludes clinical pathogen diagnostics. Use mock external writes. Require human review before any real deployment.
Participation guide
Strictly for research microbiology and public bacterial data curation; excludes clinical pathogen diagnostics. Use mock external writes and human review.
How work is evaluated
Identifies peptide length discrepancies between translated nucleotide sequences and RefSeq protein entries. Generates valid FHIR Observation resources with code system pointing to RefSeq accessions. Correctly flags premature termination codons inside prokaryotic CDS sequences.
Runnable source, pinned dependencies, setup commands, working interface, example outputs, recorded demo, tests, and action logs.
Challenge datasets
Public datasets, plus the private datasets you have access to.
How submissions are scored
These dimensions define what the evaluator checks and which criteria separate a passable run from a strong one.
Complete workflow
Download prokaryotic gene packages specified by RefSeq WP_ accessions through NCBI Datasets. Parse prokaryotic protein and gene multi-FASTA files using Biopython Bio.SeqIO module. Translate genomic coding intervals to check concordant peptide lengths and terminal residues. Generate FHIR Molecular Observation JSON payloads detailing translation congruence.
Missing or incorrect.
Partly complete, with documented gaps.
Complete, with reproducible evidence.
Correctness and evidence
Identifies peptide length discrepancies between translated nucleotide sequences and RefSeq protein entries. Generates valid FHIR Observation resources with code system pointing to RefSeq accessions. Correctly flags premature termination codons inside prokaryotic CDS sequences.
Missing or incorrect.
Partly complete, with documented gaps.
Complete, with reproducible evidence.
Review interface
Console dashboard displaying accession parsing progress, peptide length delta indicators, and JSON downloads.
Missing or incorrect.
Partly complete, with documented gaps.
Complete, with reproducible evidence.
Safe execution
Strictly for research microbiology and public bacterial data curation; excludes clinical pathogen diagnostics.
This dimension contributes its full weight only when the submission satisfies the requirement. Partial credit is not awarded.
What you should walk away with
Download prokaryotic gene packages specified by RefSeq WP_ accessions through NCBI Datasets.
Parse prokaryotic protein and gene multi-FASTA files using Biopython Bio.SeqIO module.
Translate genomic coding intervals to check concordant peptide lengths and terminal residues.
Generate FHIR Molecular Observation JSON payloads detailing translation congruence.
Reference links and supporting material
Fetch synthetic WP_ bacterial accessions using mock zip payloads simulating NCBI Datasets CLI prokaryotic outputs. Supplied starter examples are synthetic, not source extracts.
Challenge setup
Configuration summary for this challenge.
Challenge input
Input details are not configured.
Mastra AI
TypeScript agent framework.
Evaluated output
No output checks are configured.
- Download prokaryotic gene packages specified by RefSeq WP_ accessions through NCBI Datasets. Parse prokaryo...
- Identifies peptide length discrepancies between translated nucleotide sequences and RefSeq protein entries....
- Console dashboard displaying accession parsing progress, peptide length delta indicators, and JSON downloads.
- 2 public reference cases
- 2 configured tools
Summary shows the first task, up to three tools, and up to three evidence items. Open the technical recipe to view all configured items.
View technical recipe
Configured tools
- Mastra AI · Optional
- Mastra AI · Optional
Evaluation contract
- Complete workflow · Weight 40
- Correctness and evidence · Weight 30
- Review interface · Weight 20
- Safe execution · Weight 10
Reference cases
- 2 public reference cases
Workflow tasks
No workflow tasks are configured.
Recipe freeze marker
No recipe freeze time is recorded.