Build a Gene Transcript FASTA Curation Pipeline with DSPy and FHIR

Parse eukaryotic gene packages from NCBI Datasets to validate transcript coding sequences with Biopython. Structure sequence verification summaries into FHIR Molecular Observation resources.

Bioinformatics Curation Specialist

Unpack NCBI Datasets zip archive containing transcript rna.fna and data_report.jsonl.

Parse transcript sequences using Biopython SeqIO to check start and stop codon integrity.

Execute a DSPy signature to categorize transcript completeness based on sequence coordinates.

Construct FHIR R5 Observation resources containing sequence validity status for curator review.

Web curation console with sequence audit tables and interactive JSON bundle inspector.

Download open NCBI Datasets packages using CLI for gene ID 672 or read bundled mock fixture zip archives. Starter examples below are synthetic. They are not downloaded records.

NCBI Datasets gene download Utilizes the NCBI Datasets gene data package structure containing transcript RNA sequences and data report lines.

dspy, biopython, pydantic. DSPy compiles robust prompt pipelines to extract structured metadata assessments from open reading frame audits. Local quantized Llama 3 or hosted small instruction model via standard API.

Submit runnable source, pinned dependencies, setup commands, a working interface, example outputs, and a recorded end-to-end demo. Include tests and an action log.

Extracts valid SeqRecord instances from transcript FASTA input without fatal parser exceptions.

Outputs valid FHIR R5 Observation JSON containing code 'molecular-sequence-assessment'.

Flags incomplete reading frames lacking standard ATG initiation codons with warning status.

```json [ { "input": { "gene_id": "672", "fasta_header": "NM_007294.4 Homo sapiens BRCA1 transcript variant 1", "sequence": "ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGTGTCCCATCTGA" }, "expected_output": { "resourceType": "Observation", "status": "final", "code": { "coding": [ { "system": "http://example.org/fhir/codes", "code": "molecular-sequence-assessment" } ] }, "valueString": "complete_cds", "component": [ { "code": { "text": "has_valid_start_and_stop" }, "valueBoolean": true } ] } }, { "input": { "gene_id": "672", "fasta_header": "NM_007294.4_truncated Homo sapiens BRCA1 partial", "sequence": "TTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGTGTCCC" }, "expected_output": { "resourceType": "Observation", "status": "preliminary", "code": { "coding": [ { "system": "http://example.org/fhir/codes", "code": "molecular-sequence-assessment" } ] }, "valueString": "incomplete_cds", "component": [ { "code": { "text": "has_valid_start_and_stop" }, "valueBoolean": false } ] } } ] ```

Research software only; outputs are non-diagnostic and must undergo curator sign-off before biobank indexing. Use mock external writes. Require human review before any real deployment.