Build a Biopython FASTA Cleanser and IUPAC Code Quality Auditor

Audit high-throughput FASTA sequence submissions for non-standard nucleotide characters and low-complexity regions. Generate structured FHIR DiagnosticReport payloads with quality metrics.

Sequencing Core Analyst

Read uploaded multi-FASTA files using Biopython SeqIO parsing iterators.

Identify ambiguous IUPAC nucleotide symbols, degenerate stretches, and uncalled base runs.

Compute per-sequence GC percentage, sequence length, and ambiguous character frequencies.

Construct FHIR Molecular Observation entries detailing quality scores for bioinformatic pipelines.

Interactive upload web portal with real-time sequence quality charts and downloadable audit reports.

Generate synthetic FASTA files with intentional IUPAC ambiguous characters (N, R, Y, S, W) locally. Starter examples below are synthetic. They are not downloaded records.

Biopython Uses Biopython Bio.SeqIO and sequence manipulation methods described in Biopython README and documentation.

langfuse, biopython, fastapi. Tracks audit latency, quality parameter distributions, and sequence drift metrics across incoming batches. Lightweight hosted language model for summarizing sequence anomaly reports into natural language.

Submit runnable source, pinned dependencies, setup commands, a working interface, example outputs, and a recorded end-to-end demo. Include tests and an action log.

Flags non-IUPAC characters and calculates ambiguous base percentages accurately.

Serializes sequence quality statistics into valid FHIR Molecular Observation resources.

Processes multi-record FASTA files streaming line-by-line without high memory consumption.

```json [ { "input": { "record_id": "SEQ-001", "sequence": "ATGCGTACCGGTTACGTACCGTTAGGCTAGCTAGGCTACGTACGTAGCTAGCTAG" }, "expected_output": { "record_id": "SEQ-001", "length_bp": 56, "gc_content_pct": 51.79, "ambiguous_count": 0, "pass_qc": true, "fhir_observation_status": "final" } }, { "input": { "record_id": "SEQ-002", "sequence": "ATGCGNNNNCGGTTRYSTAGCTAGZZZCTAG" }, "expected_output": { "record_id": "SEQ-002", "length_bp": 31, "gc_content_pct": 38.71, "ambiguous_count": 8, "invalid_chars": [ "Z" ], "pass_qc": false, "fhir_observation_status": "preliminary" } } ] ```

Quality assurance on research and de-identified sequencing data only; no medical decision support. Use mock external writes. Require human review before any real deployment.